Multidrug-Resistant Fluoroquinolone Resistance Genes and ESBL -Producing Escherichia coli and Salmonella sp. in a Broiler Breeder Farm in Ibadan: A Case Report
Abstract
The poultry industry is a critical reservoir of antimicrobial-resistant bacteria, with Escherichia coli and Salmonella sp. as major disease-causing organisms that disseminate high-priority resistance genes into the food chain. This case report details the molecular detection and characterization of plasmid-mediated quinolone resistance (PMQR), carbapenemase, and extended-spectrum β-lactamase (ESBL) genes in isolates of multidrug-resistant E. coli and Salmonella sp. obtained from a broiler breeder farm in Ibadan, Oyo State, Nigeria. Post-mortem examination was conducted on 12 broiler breeders presenting with septicemia. One representative Escherichia coli isolate and one Salmonella sp. isolate from pooled liver, kidney, and gallbladder samples with obvious gross post-mortem lesions were identified based on colony morphology on differential media (MacConkey agar), Gram’s reaction, and biochemical tests using the Analytical Profile Index. The isolates were tested for susceptibility to antibacterial agents with the Kirby-Bauer method. The isolates were also screened for ESBL (blaSHV, blaTEM, blaOXA-1, blaCTX-M), carbapenemase (blaNDM, blaKPC, blaIMP), and PMQR (qnrA, qnrB, qnrS) genes using PCR. The E. coli and Salmonella sp. isolates were resistant to all 12 tested antibiotics across six classes. The E. coli isolate had the blaTEM, blaOXA-1, blaNDM, qnrA, and qnrS genes; the Salmonella sp. isolate carried blaOXA-1 and qnrS. This report confirms that poultry serve as a reservoir for bacteria co-harboring critical ESBL, carbapenemase, and PMQR genes, thereby exhibiting severe multidrug resistance. The findings point to a serious public health concern and underscore the need for improved antimicrobial stewardship and surveillance in the food animal industries.
Introduction
Antimicrobial resistance (AMR) is a significant global health problem, affecting animals, the environment, and humans (Ahmed et al., 2024). The menace of multidrug resistance has further worsened the problem, restricting treatment options, particularly in humans and animals (Rathored & Budhbaware, 2025). Recently, enteric bacteria such as Salmonella sp. and Escherichia coli have increasingly been recognized for their high resistance to first-line antibiotics and even to antibiotics regarded as a last resort in the management of life-threatening bacterial diseases in both animals and humans (Poirel et al., 2018; Kumar et al., 2025).
The poultry sector is an essential source of animal protein in many developed and developing countries, including Nigeria. It plays an essential part in meeting humans' daily protein needs through egg and meat consumption (Attia et al., 2022). However, this industry is a significant contributor to antimicrobial resistance due to the misuse of antibiotics for disease prevention and management, as well as to boost growth (Mulchandani et al., 2023; Jemilehin et al., 2024).
Resistance to β-lactams (including cephalosporins, carbapenems, and penicillins) and fluoroquinolone antibiotics is of particular concern, as these antibiotics are critical for the management of life-threatening bacterial diseases (Foudraine et al., 2021; Kherroubi et al., 2024). Apart from phenotypic resistance exhibited by most bacteria to these classes of antibiotics, some bacteria carry plasmid-mediated quinolone resistance (PMQR) genes and Extended-spectrum β-lactamases (ESBLs), which confer resistance to these important and commonly used antimicrobials, thereby limiting therapeutic options in both animal and human medicine (Shaikh et al., 2015). Genes such as blaTEM, blaSHV, blaKPC, blaOXA-1, and blaNDM are frequently implicated in β-lactam resistance, while quinolone resistance is often associated with qnr genes (qnrA, qnrB, qnrS) (Jemilehin et al., 2024). The qnr genes are plasmid-borne and facilitate horizontal gene transfer, thereby enhancing their ability to spread across bacterial populations and making such bacteria a significant public health risk (Jemilehin et al., 2024; Poirel et al., 2016).
The detection of bacteria resistant to multiple antibiotics, with associated ESBL and quinolone resistance genes, within the food chain not only compromises animal health and production but could also be a source of resistant bacteria transmitted to people and the ecosystem (Juraschek et al., 2022; Ballash et al., 2024). This underscores the need for continuous screening and maintenance of strict biosecurity practices to protect the food chain, especially animals that are mostly consumed, such as poultry, from multidrug-resistant bacteria. This will help to make evidence-based interventions and promote the judicious use of antibiotics. This case reports the molecular detection and characterization of PMQR and ESBL in multidrug-resistant Salmonella sp. and E. coli isolates from poultry.
Case Detail Presentation
Case History and Flock Description (August 08, 2025)
Twelve (12) fresh carcasses of 9-week-old female Arbor Acre broiler breeders were presented at the poultry diseases clinic, Veterinary Teaching Hospital, University of Ibadan. History showed an average daily mortality of about 25 birds continuously for about 15 days before presentation. The birds were floor-reared, with a total population of 16,000, divided equally between two pens designated Houses 1 and 2. They were maintained on a self-compounded broiler breeder ration, and water was provided ad libitum through a nipple drinking system. The feather's appearance was dirty, with litter adhering to the claws. Yellowish-whitish diarrheic fecal pasting was observed around the vent area in the majority of the carcasses presented.
Postmortem Findings
There was marked thickening of the air sacs with whitish exudates, marked perihepatitis and pericarditis; the liver was observed to be darkish-brown in color with some areas of necrosis, while the gallbladder was observed to be markedly engorged, as shown in Figure 1. Mucoid enteritis was pervasive throughout the intestine, with yellowish pasting of the vent area. The kidneys were mildly swollen, and there was a hemorrhage presenting as a zebra-like appearance in the colon.
Sample Collection
Tissue samples from the kidneys, gall bladder, and liver with gross pathological lesions were aseptically harvested at post-mortem into sterile Petri dishes. Samples were submitted for microbiology culture and sensitivity within 2 hours of case presentation.
Microbial Culture and Identification
The samples were pooled and inoculated in Buffered peptone water for 24 hours at 37°C. To allow bacterial growth, the inoculum was subcultured onto MacConkey agar plates and incubated at 37°C for 24–48 h; discrete colonies were Gram-stained. The Lactose fermenter colonies on MacConkey agar were subcultured on eosin methylene blue agar at 37°C for twenty-four hours (Chowdhury et al. 2020; Bedair et al. 2025). A representative bacterial colony was selected for biochemical identification and antibiotic susceptibility testing. The API 20E kit and the APIWEB software were used to identify the non-lactose fermenter and the Gram-negative lactose fermenter colonies (bioMéieux, France).
Molecular identification
The Weerakkody and Witharana (2024) protocol was used to extract DNA. PCR was used to screen the isolates for the presence of blaTEM, blaSHV, blaKPC, blaIMP, blaNDM, blaOXA-1, blaCTX, qnrA, qnrB, and qnrS genes at 258bp, 319bp, 498bp, 568bp, 624bp, 190bp, 598bp, 516bp, 469bp, and 417bp, respectively, as previously described (Table 1). Reaction cocktail used for all PCR per primer set included (Reagent Volume µl) - 5X PCR SYBR green buffer (2.5), MgCl2 (0.75), 10 pM DNTP (0.25), 10 pM of each forward and reverse primer (0.25), 8000U of Taq DNA polymerase (0.06), and made up to 10.5 with sterile distilled water to which 2 µl template was added. The recycling conditions consisted of an initial denaturation for 5 minutes at 94°C, 35 cycles of denaturation at 94°C for 30 seconds, annealing at 50°C for 40 seconds, extension at 72°C for 40 seconds, and a final extension at 72°C for 10 minutes. An ordinary buffer with no DNA was run alongside as a negative control. Electrophoresis was used to separate the amplicons on a 1.5% agarose gel in Tris-Borate EDTA buffer at 110 volts for an hour. A 100 bp DNA ladder was used, and the DNA fragments were visualized using a Trans UV Illuminator after staining with ethidium bromide.
Gene | Primer sequence 5’-3’ | Band size (bp) | References |
|---|---|---|---|
BlaCTX | Forward: TTTGCGATGTGCAGTACCAGTAA Reverse: CGATATCGTTGGTGGTGCCATA | 598 | Monstein et al., 2007 |
blaIMP |
| 568 | Mahmoud et al., 2020 |
blaKPC |
| 498 | Mahmoud et al., 2020 |
blaNDM |
| 624 | Mahmoud et al., 2020 |
blaOXA | Forward: TTCTGTTGTTTGGGTTTCGC Reverse: ACGCAGGAATTGAATTTGTT | 190 | Dallenne et al., 2010 |
blaTem | Forward: GTCGCCGCATACACTATTCTCA Reverse: CGCTCGTCGTTTGGTATGG | 258 | Cai et al., 2008 |
blaSHV | Forward: GCCTTGACCGCTGGGAAAC Reverse: GGCGTATCCCGCAGATAAAT | 319 | Dallenne et al., 2010 |
qnrA | Forward: ATTTCTCACGCCAGGATTTG Reverse: GATCGGCAAAGGTTAGGTCA | 516 | Wang et al., 2008 |
qnrB | Forward: GATCGTGAAAGCCAGAAAGG Reverse: ACGATGCCTGGTAGTTGTCC | 469 | Wang et al., 2008 |
qnrS | Forward: ACGACATTCGTCAACTGCAA Reverse: TAAATTGGCACCCTGTAGGC | 417 | Wang et al., 2008 |
Antibiotic Susceptibility Testing (AST)
The following antibacterial (Oxoid™) were used for AST according to the Kirby-Bauer disc diffusion method: ceftriaxone (30 µg), cefuroxime (30 µg), cefoxitin (30 µg), ampicillin (10 µg), gentamicin (10 µg), azithromycin (15 µg), amoxicillin+clavulanic acid (20/10 µg), ciprofloxacin (5 µg), sparfloxacin (5 µg), ofloxacin (5 µg), levofloxacin (5 µg) and pefloxacin (5 µg). These antibacterial agents include widely used antibiotics for treating bacterial infections in poultry and antibiotics of last resort for treating life-threatening and complicated bacterial infections in humans. The results were interpreted according to the CLSI (2025) guidelines. (Table 2). Standard reference strain Escherichia coli ATCC 25922 was used for quality control to ensure the reliability of the results.
Antimicrobial class | Antimicrobial tested | AST results | ||||
|---|---|---|---|---|---|---|
E. coli | Zone of inhibition(mm) | Salmonella sp. | Zone of inhibition | |||
Beta Lactam Inhibitor | Amoxicillin+Clavulanic acid (20/10 µg) | Resistant | 6 | Resistant | 6 | |
Aminoglycoside | Gentamicin (10 µg) | Resistant | 6 | Resistant | 11 | |
Macrolide | Azithromycin (15 µg) | Resistant | 6 | Resistant | 6 | |
Cephalosporin (2nd generation) | Cefuroxime (30 µg) | Resistant | 6 | Resistant | 13 | |
Cefoxitin (30 µg) | Resistant | 6 | Resistant | 6 | ||
Cephalosporin (3rd generation) | Ceftriaxone (30 µg) | Resistant | 15 | Resistant | 12 | |
Fluoroquinolones | Ofloxacin (5 µg) | Resistant | 6 | Resistant | 6 | |
Ciprofloxacin (5 µg) | Resistant | 6 | Resistant | 6 | ||
Pefloxacin (5 µg) | Resistant | 6 | Resistant | 6 | ||
Levofloxacin (5 µg) | Resistant | 8 | Resistant | 6 | ||
Sparfloxacin (5 µg) | Resistant | 11 | Resistant | 13 | ||
Penicillin derivative | Ampicillin (10 µg) | Resistant | 6 | Resistant | 10 | |
Results
One Salmonella sp. (96.3%) and one E. coli (99.8%) were confirmed by colonial morphology and biochemical identification (API 20E).
The E. coli isolate was positive for blaTEM, blaOXA-1, blaNDM, qnrS, and qnrA, while the Salmonella sp.isolate was positive for blaOXA-1 and qnrS (Figures 2 and 3).
The bacteria showed complete resistance to all 12 antibiotics (Table 2).
Discussion
This case reports the detection of Salmonella sp. and E. coli that were multidrug-resistant (MDR), demonstrating that food animals, especially poultry, are substantial reservoirs of clinically significant resistance genes. The detection of blaTEM and blaOXA-1 in the Escherichia coli isolate indicates that the bacterial isolate is a strain that produces ESBL. blaNDM, a carbapenemase gene, was detected in the isolates. Carbapenemase genes, particularly NDM, are critical because they confer resistance to carbapenems, which are among the last-line antibiotics in human medicine (Song et al., 2025). Although blaCTX-M and blaSHV were not detected, the presence of multiple β-lactamase genes in an isolate indicates an increased likelihood of MDR and the potential for these resistance genes to spread within the ecosystem (Chen et al., 2022; Ruiz et al., 2025). The Salmonella sp. isolate also harbored blaOXA-1, a significant finding suggesting the potential presence of additional β-lactamase genes (Orole et al., 2024). This report is consistent with previous reports of OXA-type β-lactamases in Salmonella sp. isolates from poultry (Zhao et al., 2017).
The detection of PMQR genes in the bacteria further highlights significant public health implications. Both isolates carried qnrS, while the E. coli isolate additionally carried qnrA, indicating multiple mechanisms that could contribute to fluoroquinolone resistance. The qnr genes are PMQR genes that confer quinolone resistance by protecting topoisomerase IV and DNA gyrase from quinolone inhibition, thereby facilitating the emergence of significant fluoroquinolone resistance under selective pressure (Amel et al., 2024). Similar studies in wild and domestic birds have suggested that avian populations contribute significantly to the dissemination of antibiotic-resistant genes, including PMQR genes, across ecological boundaries (Ong et al., 2020; Ghasabsaraei et al., 2026). The combined presence of qnrS in the two isolates, together with qnrA in the E. coli isolate, suggests a possible risk of plasmid transfer to other bacterial species within poultry production systems, among handlers and consumers of poultry products, and in the environment.
The detection of ESBL, PMQR, and carbapenemase genes in the isolates recovered from broiler breeders is of serious epidemiological concern, given the multiple pathways through which these resistance genes can be disseminated to animals, the environment, and people. Broiler breeders are long-lived birds, with their chicks often sold to several commercial broiler farms across different geographic locations worldwide (Riber & Wurtz, 2024; Ibayi et al., 2025). Invariably, resistance genes from such animals can be vertically transmitted to their eggs and chicks, which are then sold to other farms, thereby spreading these genes to other farms, regions, and the environment. In addition, these resistance genes could be transmitted via farm workers, poultry manure, slaughtering knives, equipment, and so on (Chen et al., 2025; Ren et al., 2025).
Phenotypically, the antimicrobial susceptibility test revealed complete resistance (100%) to all tested antibiotics, including fluoroquinolones, cephalosporins, β-lactams, aminoglycosides, and macrolides. This level of resistance is consistent with molecular detection of β-lactamase and PMQR genes. Multidrug-resistant poultry isolates have been previously shown to transmit resistance genes through direct contact, fecal contamination, or environmental pathways to animals, humans, and the environment (Scicchitano et al., 2024). The coexistence of ESBL, carbapenemase, and PMQR genes in the same bacteria underscores the serious threat posed by the misuse of antimicrobials in food-producing animals, especially poultry, and its contribution to increasing antimicrobial resistance.
This case report has several limitations. Only one representative E. coli isolate and one representative Salmonella sp. isolate were selected from pooled organ samples; therefore, the findings cannot be used to estimate prevalence, flock-level distribution, or farm-level burden of resistance. Salmonella sp. was not confirmed by serotyping or molecular confirmation, such as invA PCR. In addition, sequencing of resistance genes and positive controls for all PCR targets were not available. Therefore, the findings should be interpreted as the detection of resistance genes in representative isolates from a clinical case, and broader surveillance is required to confirm their epidemiological significance.
In conclusion, this case report is among the few reports demonstrating the concurrent presence of PMQR, ESBL, and carbapenemase genes in Salmonella sp. and E. coli from poultry in Nigeria. These findings suggest that poultry may be a significant reservoir of high-risk antibiotic-resistant genes, with serious public health implications. Further research is recommended to expand understanding of the potential for horizontal gene transmission, the spread of resistant strains in the environment, and the poultry industry’s contribution to the menace of AMR.
AI Use Statement
An AI tool (Grammarly, Free version) was used for language editing during manuscript preparation.
Conflict of Interest
The authors have no conflicts of interest.
Authors’ Contributions
OOE carried out the post-mortem examination, managed the flock, and contributed to writing the manuscript. The laboratory analysis and manuscript preparation were completed by FOJ, AOO, and TOO. VEA and TAE oversaw the case and helped edit the manuscript. The final text was reviewed and approved by all authors.
Data Availability Statement
All data generated or analyzed during this study are included in this published article.
Ethical Considerations
This case report was based on a routine postmortem diagnostic examination and laboratory investigations conducted at the Avian Unit of the Veterinary Medicine Department, University of Ibadan, Nigeria, following the submission of dead broiler breeder carcasses by the farm owner/custodian. No experimental procedures were performed on live birds for research purposes, and no birds were euthanized specifically for this study; therefore, formal institutional animal ethics approval was not required. Owner/custodian consent was obtained for necropsy, diagnostic sampling, laboratory testing, and publication of the case information and images. All postmortem procedures, sample collection, handling, and laboratory analyses were performed for diagnostic purposes and in accordance with institutional animal welfare principles, accepted veterinary ethical standards, and appropriate biosafety and biosecurity practices.
Funding
We received no funding for this case report.
References
Ahmed, S. K., Hussein, S., Qurbani, K., Ibrahim, R. H., Fareeq, A., Mahmood, K. A., et al. (2024). Antimicrobial resistance: Impacts, challenges, and prospects. Journal of Medicine, Surgery, and Public Health, 2, 100081. doi 10.1016/j.glmedi.2024.100081
Amel, R., Abderrazek, B., Sana, F., Ahmed, S., Mariem, Z., Lamia, K., et al. (2024). Molecular mechanisms impact on fluoroquinolone resistance among E. coli from enteric carriage monitoring before prostate biopsy and earliest description of qnr B81. Scientific Reports, 14(1), 29324. doi 10.1038/s41598-024-77844-2
Attia, Y. A., Rahman, M. T., Hossain, M. J., Basiouni, S., Khafaga, A. F., Shehata, A. A., et al. (2022). Poultry production and sustainability in developing countries under the COVID-19 crisis: Lessons learned. Animals, 12(5), 644. doi 10.3390/ani12050644
Ballash, G. A., Parker, E. M., Mollenkopf, D. F., & Wittum, T. E. (2024). The One Health dissemination of antimicrobial resistance occurs in both natural and clinical environments. Journal of the American Veterinary Medical Association, 262(4), 451-458. doi 10.2460/javma.24.01.0056
Bedair, H. M., Emara, M., Ali, S. M., Samir, T. M., & Khalil, M. A. (2025). Phenotypic and genotypic screening of multidrug resistant Klebsiella pneumoniae isolated from ready to eat street food in Tanta, Egypt. BMC Microbiology, 25(1), 65. doi 10.1186/s12866-025-03769-z
Chen, X., Zhang, E., Abdulai, M. K., Tia, A. B., Ngegba, E. D., Yin, J., et al. (2022). Dissemination of Antibiotic Resistance Genes Among Patients with Diarrhea—Freetown, Sierra Leone, 2018. China CDC Weekly, 4(49), 1093. doi 10.46234/ccdcw2022.221
Chen, Y., Liu, Y., Zhao, C., Ma, J., & Guo, J. (2025). Antibiotic resistance gene pollution in poultry farming environments and approaches for mitigation: A system review. Poultry Science, 104(3), 104858. doi 10.1016/j.psj.2025.104858
Chowdhury, A. M. A., Akter, S., & Mina, S. A. (2020). Isolation, identification and functional characterization of Escherichia coli as probiotic against Shigella in Bangladesh. Indian Journal of Microbiology Research, 7, 313-321. doi 10.18231/j.ijmr.2020.056
Cai, J. C., Zhou, H. W., Zhang, R., & Chen, G. X. (2008). Emergence of Serratia marcescens, Klebsiella pneumoniae, and Escherichia coli isolates possessing the plasmid-mediated carbapenem-hydrolyzing β-lactamase KPC-2 in intensive care units of a Chinese hospital. Antimicrobial Agents and Chemotherapy, 52(6), 2014-2018. doi 10.1128/aac.01539-07
Clinical and Laboratory Standards Institute (2025). Performance standards for antimicrobial susceptibility testing (35th ed., CLSI supplement M100). Clinical and Laboratory Standards Institute.
Dallenne, C., Da Costa, A., Decré, D., Favier, C., & Arlet, G. (2010). Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. Journal of Antimicrobial Chemotherapy, 65(3), 490-495. doi 10.1093/jac/dkp498
Foudraine, D. E., Strepis, N., Stingl, C., Ten Kate, M. T., Verbon, A., Klaassen, C. H., et al. (2021). Exploring antimicrobial resistance to beta-lactams, aminoglycosides and fluoroquinolones in E. coli and K. pneumoniae using proteogenomics. Scientific Reports, 11(1), 12472. doi 10.1038/s41598-021-91905-w
Ghasabsaraei, K. T., Ahoodashti, H. M., Shateri, S., Alipour, M., & Barari, M. (2026). Molecular Characterization of Plasmid-Mediated Fluoroquinolone Resistance Genes (qnr, oqxAB, aac (6′)-Ib-cr, qepA) in Avian Pathogenic Escherichia coli from Broiler Flocks with Colibacillosis in Northern Iran. Journal of Poultry Sciences and Avian Diseases, 4(1), 1-8. doi 10.61838/kman.jpsad.153
Ibayi, E. L., Nyambura, J. N., Guyo, B. A., Moodley, A., & Muloi, D. M. (2025). Mapping the flow of commercial broiler day-old chicks in Kenya. Frontiers in Veterinary Science, 12, 1607825. doi 10.3389/fvets.2025.1607825
Jemilehin, F. O., Ogunleye, A. O., & Ajuwape, A. T. P. (2024). Plasmid-Mediated Quinolone Resistance (PMQR) determinants in multidrug-resistant, non-ESBL-producing, non-typhoidal Salmonella species isolated from commercial laying chickens. International Journal of Environmental Studies, 81(4), 1823-1835. doi 10.1080/00207233.2023.2192619
Juraschek, K., Malekzadah, J., Malorny, B., Käsbohrer, A., Schwarz, S., Meemken, D., et al. (2022). Characterization of qnrB-carrying plasmids from ESBL-and non-ESBL-producing Escherichia coli. BMC Genomics, 23(1), 365. doi 10.1186/s12864-022-08564-y
Kherroubi, L., Bacon, J., & Rahman, K. M. (2024) Navigating fluoroquinolone resistance in Gram-negative bacteria: a comprehensive evaluation. JAC-Antimicrobial Resistance, 6(4), dlae127. doi 10.1093/jacamr/dlae127
Kumar, R., Adeyemi, N. O., Chattaraj, S., Alloun, W., Thamarsha, A., Anđelković, S., et al. (2025). Antimicrobial resistance in Salmonella: One Health perspective on global food safety challenges. Science in One Health, 4, 100117. doi 10.1016/j.soh.2025.100117
Mahmoud, N. E., Altayb, H. N., & Gurashi, R. M. (2020). Detection of Carbapenem‐Resistant Genes in Escherichia coli Isolated from Drinking Water in Khartoum, Sudan. Journal of Environmental and Public Health, 2020(1), 2571293. doi 10.1155/2020/2571293
Monstein, H. J., ÖSTHOLM‐BALKHED, A., Nilsson, M. V., Nilsson, M., Dornbusch, K. & Nilsson, L. E. (2007). Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX‐M genes in Enterobacteriaceae. Journal of Pathology Microbiology and Immunology, 115(12), 1400-1408. doi 10.1111/j.1600-0463.2007.00722.x
Mulchandani, R., Wang, Y., Gilbert, M., & Van Boeckel, T. P. (2023). Global trends in antimicrobial use in food-producing animals: 2020 to 2030. PLOS Global Public Health, 3(2), e0001305. doi 10.1371/journal.pgph.0001305
Nabil, N. M., Tawakol, M. M., Samir, A., Hassan, H. M., Yonis, A. E., Reda, R. M., et al. (2023). Synergistic influence of probiotic and florfenicol on embryonic viability, performance, and multidrug-resistant Salmonella Enteritidis in broiler chickens. Scientific Reports, 13(1), 9644. doi 10.1038/s41598-023-36238-6
Ong, K. H., Khor, W. C., Quek, J. Y., Low, Z. X., Arivalan, S., Humaidi, M., et al. (2020). Occurrence and antimicrobial resistance traits of Escherichia coli from wild birds and rodents in Singapore. International Journal of Environmental Research and Public Health, 17(15), 5606. doi 10.3390/ijerph17155606
Orole, O. O., Lamini, J. N., & Chuku, A. (2024). Phylogenetic characterization of resistant Salmonella strains in typhoid fever patients in Nigeria. Bioinformatics and Biology Insights, 18, 11779322231220194. doi 10.1177/11779322231220194
Poirel, L., Kieffer, N., Liassine, N., Thanh, D., & Nordmann, P. (2016). Plasmid-mediated carbapenem and colistin resistance in a clinical isolate of Escherichia coli. The Lancet Infectious Diseases, 16, 281. doi 10.1016/s1473-3099(16)00006-2
Poirel, L., Madec, J. Y., Lupo, A., Schink, A. K., Kieffer, N., Nordmann, P., et al. & (2018). Antimicrobial resistance in Escherichia coli. Microbiology Spectrum, 6(4), 10-1128. doi 10.1128/microbiolspec.arba-0026-2017
Rathored, J., & Budhbaware, T. (2025). Integrative Strategies Against Multidrug-Resistant Bacteria: Synthesizing Novel Antimicrobial Frontiers for Global Health. Microbial Pathogenesis, 208, 108018. doi 10.1016/j.micpath.2025.108018
Ren, L., Li, Y., Ye, Z., Wang, X., Luo, X., Lu, F., et al. (2025). Explore the Contamination of Antibiotic Resistance Genes (ARGs) and Antibiotic-Resistant Bacteria (ARB) of the Processing Lines at Typical Broiler Slaughterhouse in China. Foods, 14(6), 1047. doi 10.3390/foods14061047
Riber, A. B., & Wurtz, K. E. (2024). Impact of growth rate on the welfare of broilers. Animals, 14(22), 3330. doi 10.3390/ani14223330
Ruiz, S. E., Morandini. F. N., Panzetta, M. E., Lipari, F. G., Irrazábal, M. G., Toselli, R., et al. (2025). Urban wastewater overflows as hotspots for dissemination of bacteria producing extended-spectrum β-lactamases and carbapenemases in the Suquía River, Argentina. Frontiers in Microbiology, 16, 1669531. doi 10.3389/fmicb.2025.1669531
Scicchitano, D., Babbi, G., Palladino, G., Turroni, S., Mekonnen, Y. T., Laczny, C., et al. (2024). Routes of dispersion of antibiotic resistance genes from the poultry farm system. Science of the Total Environment, 912, 169086. doi 10.1016/j.scitotenv.2023.169086
Shaikh, S., Fatima, J., Shakil, S., Rizvi, S. M. D., & Kamal, M. A. (2015). Antibiotic resistance and extended spectrum beta-lactamases: Types, epidemiology and treatment. Saudi Journal of Biological Sciences, 22(1), 90-101. doi 10.1016/j.sjbs.2014.08.002
Song, H. W., Lin, Y., Wan, T. E., Yang, G. H., Jiang, M. T., Fu, B. H., et al(2025) Global burden of Klebsiella pneumoniae infections and antimicrobial resistance in 2019. BMC Infectious Diseases, 25(1), 1773. doi 10.1186/s12879-025-12120-w
Wang, A., Yang, Y., Lu, Q., Wang, Y., Chen, Y., Deng, L., et al. . (2008). Presence of qnr gene in Escherichia coli and Klebsiella pneumoniae resistant to ciprofloxacin isolated from pediatric patients in China. BMC Infectious Diseases, 8(1), 68. doi 10.1186/1471-2334-8-68
Weerakkody, L. R., & Witharana, C. (2024). A rapid, inexpensive and effective method for the efficient isolation of genomic DNA from Gram-negative bacteria. Molecular Genetics and Genomics, 299(1), 26. doi 10.1007/s00438-024-02120-x
Zhao, X., Ye, C., Chang, W., & Sun, S. (2017). Serotype distribution, antimicrobial resistance, and class 1 integrons profiles of Salmonella from animals in slaughterhouses in Shandong Province, China. Frontiers in Microbiology, 8, 1049. doi 10.3389/fmicb.2017.01049